Sequence Report: MarkmEps7

General information about the entry
Gene nameMarkmEps7
Primary accession numberMarkmEps7.NA
Secondary accession number(s).
Sequence typeRNA
Sequence originSugen
Sequence length775
Sequence description.
>MarkmEps7_Mm
TGTGAGGACTTTGGATCCAACCCTTTTAAGGAAGAGGCTTTAACTGAACTCTATAAAATCTTAATGACCCTAGGCCAAGG
AGTATTCCGTGAAGAAAAATTAGTAAGCCATCTCCTCACCCAGACTATGGTTACAGTTAAAATTCTTACAAAATGCAGAA
AGAGCACCATCATAAAATCAGAATTTGAAATTACAAAACCTCTACGCCAACCTGTATTATTAAACTTTTGCACATTTTTG
ATAAAAACATATGATTCTGACCCTCAGGGTTGGAGGAGAGGAGTTGGGCAGAATTTTGGAGTTTGGATACCTACTGGAGA
AAGAATAGTCTTTAAATGAATGGTGTATGCCCTCCAGTATTGTCACCAGAAACATAGTGCCCACAGGCATTTAAAACCTG
AAAATATTTTAGTGAACTGCAAAGGAAATATAAAACTTAGCTATTTCAGATTGGGCAAAAGGATTATCATGGGCCAGAAA
CTAGCAACTTTCTGTGGGACCCTTCCTTACTGTGCCTTACAACTCTTTGAAGTATAAGGGGATGATAGCTGTGCAGTTGA
TGTCTGGAGCTAAGGGGTCATGCTCTACATTGTGTCAACTGGATGCTTCCCTTTCCAGGGACATAACTATGATGAACTAA
AGCAGAACACCTTGGCAGAAAAGTACTCTGTAAAATTCTAGCTGTCACAAGAACTTTGTGACAAGATTGCTGAATTGTGA
ACTGTAAACCCTGGACAAAAGCCAAGAGTACACAACACTGGGAGCTTTCAATGGC