Sequence Report: MARKps12

General information about the entry
Gene nameMARKps12
Primary accession numberMARKps12.NA
Secondary accession number(s).
Sequence typeRNA
Sequence originSugen Kinome
Sequence length744
Sequence description.
>MARKps12_Hs
CCTCACCTGGCAAAAAGATACAAAACTATGGGATCCTTGACACCATCCGCCAGGGAACTGGCCCGGCATAGGCTAACTGG
GACCCAAATTGTCCTCCAAATCATCCCTAAGAAGGCTGGCCTTnnnTCTCTAGAGAGAGAGATGAGTATCATGAAGACTC
TCTATCACCCAAATATCATTCAGTTCCACCAGGTGACTGACAAGGTGGAAACCATGTATGTGGTGATGGAGTACGCCAGA
GGAGGAGAGCTACAGCACCAGATATGCCACCAAGGCCACATCGAGGAAGAGGAGGCCTGAACCATGTTCAGGCAGATTCT
GTCAGCCCTGCACTACTGCCACTTGAAGAACATCnnnCACATCCACACACAAAACATGCTACTCAATGAGGAACGCAATA
TAAAAATCATGGACTTTGGCTTTAGCATGACATTCGGGGAGGCATAGATGCTGAAAACATTTTGTGGCGCGCACCCCTAC
GTGGCCACGGAACTCTTCCTGGGCCAGGAGTGCCAGnnnGCCACCATGATTGTATGGAGCCTCCGTGCCACACTGTATTC
CATGGTGGCCGGGGCCCTGCCCTTCTACTCAGGGAACCCTACAGGCCTCAAGAAAAAATGATCAGTGCAGAATACCGTTC
ACCACAATTTTTTTCCCCAACGAATGGAAAGACTTATTAAAAAGTGACTAATGCTGGACCCCAAGGAGTGTCCTTCACTG
GAACAAGTGATGAAAAATCCATAG