Sequence Report: MARKps23

General information about the entry
Gene nameMARKps23
Primary accession numberMARKps23.NA
Secondary accession number(s).
Sequence typeRNA
Sequence originSugen Kinome
Sequence length600
Sequence description.
>MARKps23_Hs
AGTTTGGCCTCCAACTCACCTAGGGAGGAGATCAAAAAGTACATGCTCCTCAAGACCATTGGCAGGGGCGTGTTCGTCAA
GGTGAAGCTAACAGGGCACATACTGACTGGGACACAGGTGGTTACAAAAATCATCTATAAAATGAGTGGCTTCCCTAGCC
TCTCTCTACAGAAAGAGGTAGAAATCATGAAGGTCCCGAATCACCTGAACATCATTAAACTCAACCAGGTGATTGGCAGG
TGGACACCCTATTTAGTGATGGAATATGCCCTCGAAGGAGTGCTTTTCCACCAAATACACCATCACAGCCACATCAAAGA
TGACAAGAAGGCCCGGGCCATGTTTAAGCAGACACCGTCCACCCTCCAGTACAGCTACAGAAAGAAAATCGTGAACTGGG
ACCTGAAGCCGCAGAACATCCTACTGCATGAAGAACATAACTTAAATATAGTCAACTTTGGTTTCAGCACCACATTTGCG
GAAGGAGAGATGCTGGGAGCCTTTTATGGGACTTGCTCTTATGTTGCCCCAGAACTCTTCCTGGGCCATGGTTACCAAGT
CCCTAACACCTTATTTCTCTCTCTAAGGCAGGTCTTTTAG